subject
Biologia, 18.08.2019 17:12 jvoliveiraneonp55fex

Considere:
acgtttaacgacaagtattaagacaagtattaa

a)esse trecho de ácido nucleico é um rna ou um dna?

b)qual seria a sequência complementar a essa cadeia? seria uma outra fita de dna ou um rna?

c)na hipótese que essa sequência fosse um gene, quantos aminoácidos formariam a proteína traduzida dele?

d) na hipótese de ser um gene, qual seria a sequência do seu rnam?

preciso de ! ‚Äč

Respostas
Respostas: 2

Outra pergunta: Biologia

question
Biologia, 15.08.2019 00:57
Oque ocorre no gr√°fico,preciso de um resumo‚Äč
Respostas: 1
question
Biologia, 15.08.2019 00:29
Qual verme vive nos vasos linfaticos do ser humano
Respostas: 3
question
Biologia, 15.08.2019 00:07
Qual é a função da testosterona produzida pelo feto masculino durante a gestação? ?
Respostas: 1
question
Biologia, 15.08.2019 00:05
De que forma surgiu a vida / onde surgiu a vida / as caracter√≠sticas dos primeiros seres vivos / a evolu√ß√£o dos primeiros seres vivos at√© a forma√ß√£o do celular‚Äč
Respostas: 2
Você sabe a resposta certa?
Considere:
acgtttaacgacaagtattaagacaagtattaa

a)esse trecho de ácido nucleico é um...
Perguntas
question
Pedagogia, 16.07.2020 01:14
question
Inglês, 16.07.2020 01:14
question
Matem√°tica, 16.07.2020 01:14
question
Matem√°tica, 16.07.2020 01:14
question
Matem√°tica, 16.07.2020 01:14
Perguntas no site: 14828912